| Field header
| Example entry
| Description
| Entry used by SNPBINNER?
|
| LabID | 1a | Internal ID number. | No
|
| ASPEname | HvSNP.1a | Internally used SNP name. | No
|
| SNPname | ABC00086_261[G/A]bot | Public name for a SNP. Names assigned by Matt Hayden to locally implemented SNP markers are composed of the contig name, a SNP's position in base pair on the contig, the single base-variation expected to occur at the SNP's location, plus the abbreviation "top" or "bot" to signify the DNA strand where the bases in question are found ("top": sequence as reported in SNP database, "bot": reverse-complement of the reported sequence). | Yes
|
| Contig | ABC00086 | Official name of the contig amplified by the "Locus-Specific Primers" ("FwdLSP" and "RevLSP"). | Yes
|
| SNPposition on contig [base pair] | 261 | Position on the contig where the single nucleotide polymorphism occurs [base pair] | No
|
| Chr | 5H | Chromosome location of a SNP marker, if known. | No
|
| MapPos | 61.416 | Map location of a SNP marker in centiMorgan, if known. (Which maps is Matt referring to?) | No
|
| LSPname | HvLSP.1 | Internal contig name. | No
|
| FwdLSPname | ABC00086_Fwd | Name of forward "locus-specific primer", used to amplify the contig where a SNP is found. | No
|
| FwdLSPsequence | GCCCAGTGAGTGTGGCCTTT | Sequence of forward "locus-specific primer", used to amplify the contig where a SNP is found. | No
|
| RvsLSPname | ABC00086_Rvs | Name of reverse "locus-specific primer", used to amplify the contig where a SNP is found. | No
|
| RvsLSPsequence | GGGGCTCACTGCAACCGTAG | Sequence of reverse "locus-specific primer", used to amplify the contig where a SNP is found. | No
|
| SNP1name | ABC00086_261[G/A]bot.1 | Name of the first of two probes used to assay the SNP. Names assigned by Matt Hayden are composed of the contig name, a SNP's position in base pair on the contig, the single base-variation expected to occur at the SNP's location, abbreviation "top" or "bot" to signify the DNA strand where the bases in question are found, followed by ".1" | No
|
| SNP1sequence | TTGATGGGCTACGGTTTG | Sequence of the first of two probes used to assay the SNP | No
|
| SNP1LUA | LUA10 | "FlexMAP tag" attached to the first of the two probes used to assay the SNP, abbreviated as "LUA (LUminex Array) number". E.g. "LUA10" refers to the "FlexMAP tag" with zip code number "10". | Yes
|
| SNP1allele | G | SNP allele identified by the first of the two probes used to assay the SNP. | No
|
| SNP2name | ABC00086_261[G/A]bot.2 | Name of the second of two probes used to assay the SNP. Names assigned by Matt Hayden are composed of the contig name, a SNP's position in base pair on the contig, the single base-variation expected to occur at the SNP's location, abbreviation "top" or "bot" to signify the DNA strand where the bases in question are found, followed by ".2" | No
|
| SNP2sequence | TTTGATGGGCTACGGTTTA | Sequence of the second of two probes used to assay the SNP | No
|
| SNP2LUA | LUA80 | "FlexMAP tag" attached to the second of the two probes used to assay the SNP, abbreviated as "LUA (LUminex Array) number". E.g. "LUA80" refers to the "FlexMAP tag" with zip code number "80". | Yes
|
| SNP2allele | A | SNP allele identified by the second of the two probes used to assay the SNP. | No
|
| excludedprobes | ABC00600_512[T/C]top, ABC01216_254[A/G]top, ABC01868_197[C/T]bot | Use this field to enter other SNPs that must not be used together with the marker, as SNP probes are known to form dimers. Identify each SNP by referring to its name as entered under header "SNPname". Please note that every row of the SNP MARKER DB IMPORT table must have all the binning information for that marker. If e.g. 3 different SNPs cannot be used together, the information has to be entered for each of the 3 SNPs in the "excludedprobes" field. If entering more than one SNPname in this field, use commas to separate entries. | Yes
|
| excludedcontigs | ABC00681, ABC02639 | Use this field to enter contigs that must not be used together with the marker, as SNP probes are known to bind to these contigs. Identify each contig by referring to its name as entered under header "Contig". Please note that every row of the SNP MARKER DB IMPORT table must have all the binning information for that marker. If entering more than one contig in this field, use commas to separate entries. | Yes
|
